Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot, Infection, Negative Control, Transfection, Luciferase, Construct, Activity Assay

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A , Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members. Ratios of RRM2 to β-actin band intensities (normalized to control) from three experiments are indicated ( top ). Asterisks indicate significant reductions ( p <0.05) in RRM2 levels compared with control. B , Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members. Original magnification, x20. C , MIA PaCa-2 cells stably overexpressing pre- let-7 family members ( red ) or vector alone ( blue ) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay. Points , mean of triplicate; bars , SE. n = 3. Gemcitabine IC 50 estimations indicated ( parentheses ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Control, Stable Transfection, Plasmid Preparation, Inhibition, MTT Assay

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, Western blotting analysis of hENT1 (∼50–55 kDa), hENT2 (50 kDa), hCNT1 (72 kDa), hCNT3 (77 kDa), CDA (55 kDa), dCK (30 kDa), RRM1 (94 kDa), RRM2 (45 kDa), and β-actin (45 kDA) levels in whole cell lysates of Capan-1 and Capan-1-GR cells. B , RRM2 protein increased in a gemcitabine dose-dependent fashion in Capan-1-GR cells. C, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) levels in cells with acquired gemcitabine resistance. Ratios of RRM2 to β-actin band intensities (normalized to untreated cells) from three experiments are indicated ( top ). Asterisk indicates significantly higher RRM2 expression in gemcitabine-resistant cells ( p <0.05) compared with untreated cells. D and E, Relative expression of precursor and mature let-7a in Capan-1 ( D ) and L3.6pl ( E ) cells induced to acquire gemcitabine resistance. Columns, mean of triplicate; bars, SD. n = 3. F , Differential miRNA expression in Capan-1-GR compared with Capan-1. Putative RRM2-modulating miRNAs and their extent of reduction in Capan-1-GR cells are shown ( right ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Expressing

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A and B, Relative expression of primary let-7a transcripts ( A ) and mature let-7a ( B ) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages. C , Ratios of mature to precursor let-7a transcripts calculated from data points in A and B . D, Western blotting analysis of RRM2 (45 kDa) in total lysates (50 µg) of 6 matched normal-PDAC pairs. Ratios of RRM2 band intensities in PDACs compared to matched normal tissues indicated ( top ). Asterisk indicates significantly higher RRM2 expression in PDAC tissues ( p <0.05) compared with matched normal tissues. E and F, Relative expression of primary let-7a transcripts ( E ) and mature let-7a ( F ) in matched normal-PDAC pairs. G , Ratios of mature to precursor let-7a transcripts calculated from data points in E and F . Asterisk indicates significantly lower mature to precursor let-7a ratio in PDAC tissues ( p <0.05) compared with matched normal tissues.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: RRM2 is highly expressed in liver cancer. a The 180 ferroptosis-related factors that were downregulated were identified by TMT, RNA-seq and DNase-seq. b RRM2 was identified as the most significantly upregulated secretory or membrane-bound protein in liver cancer via data mining using the TCGA database. c Scatter plot for serum RRM2 in healthy individuals and patients with hepatitis A, hepatitis B, hepatitis C, lung cancer, gastric cancer, breast cancer, colorectal cancer or liver cancer. d RRM2 expression in the sera from healthy individuals and liver cancer patients, as was evaluated by immunoblotting. e TMA of RRM2 in liver cancer and normal liver tissues. Representative IHC images of TMA stained with anti-RRM2 antibodies are shown. Data were analyzed using a chi-square test. f The UALCAN database was used to analyze alterations in RRM2 expression between liver cancer (n = 371) and normal liver (n = 50) tissues. g Kaplan–Meier survival plots of RRM2 were obtained from the KM plotter database. h RRM2 was highly expressed in SMMC-7721 and HepG2 cell. RRM2 expression was measured by immunoblotting with anti-RRM2 antibodies in established hepatocyte (HL-7702) and liver cancer cell lines, as indicated. The IB data are representative images from three biological replicates. **P < 0.01 indicates statistical significance. Data in c were analyzed using a one-way ANOVA test. Data in e were analyzed using a chi-square test. Data in f were analyzed using Student’s t test. Data in g were analyzed using log rank analysis

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: RNA Sequencing, Membrane, Expressing, Western Blot, Staining

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: RRM2 suppresses ferroptosis in liver cancer cells. a , b RRM2 protein ( a ) and mRNA levels ( b ) in HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown, as analyzed by immunoblotting and qPCR, respectively. c – e Cell viability ( c ), cell death ( d ) and 4-HNE levels ( e ) were measured in HepG2 and SMMC-7721 cells with ectopically expressed or knocked down RRM2 before further treatment with Fer-1, ZVAD-FMK, Nec-1 or ectopically expressed RRM2. Cell viability was measured using a CellTiter-Glo luminescent cell viability assay, cell death was measured by staining with SYTOX Green followed by flow cytometry, and 4-HNE was measured by a kit from Abcam. f , g Cell death ( f ) and 4-HNE levels ( g ) were measured in HepG2 and SMMC-7721 cells treated with erastin (10 μM, 24 h) in the presence or absence of Fer-1 (1 μM, 24 h). The cells were also cultured with or without RRM2 T33E transfection, as indicated. h – j The levels of GSH ( h ), labile iron ( i ) and membrane-anchored phospholipids ( j ) in HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown were analyzed. The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. Data from b − j were analyzed using a one-way ANOVA test

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Over Expression, Knockdown, Western Blot, Cell Viability Assay, Staining, Flow Cytometry, Cell Culture, Transfection, Membrane

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: RRM2 upregulates GSH by sustaining GSS. a The ferroptosis-related metabolic axis from glucose to GSH. b – g The levels of glycine ( b ), glutamate ( c ), cysteine ( d ), cystathionine ( e ), serine ( f ) and glucose ( g ) were measured in HepG2 and SMMC-7721 cells with or without ectopically expression or knocked down of RRM2. h , i mRNA levels of CBS , CTH , SHMT2 , GSS and GPX4 were analyzed by qPCR in HepG2 ( h ) and SMMC-7721 cells ( i ) administered the indicated treatment. j , k Protein levels of CBS, CTH, SHMT2, GSS and GPX4 were analyzed by immunoblotting in HepG2 and SMMC-7721 cells ( j ). The level of RRM2 was normalized to that of GAPDH, and the normalized level of RRM2 in the untreated group was arbitrarily set to 100% ( k ). ( l ) GSH levels were measured in WT and GSS −/− HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown, as indicated. The data are shown as the mean ± SD from three biological replicates. **P < 0.01 indicates statistical significance. Data from b − i and k − l were analyzed using one-way ANOVA

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Expressing, Western Blot, Over Expression, Knockdown

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Phosphorylation of RRM2 at T33 protects GSS from proteasome degradation. a pRRM2 and RRM2 were measured by immunoblotting using anti-RRM2 antibodies following electrophoresis in gels containing Phos-tag™, while GSS was measured by immunoblotting using anti-GSS antibodies following electrophoresis in conventional gels. HepG2 and SMMC-7721 cells were cultured in the presence or absence of erastin (10 μM) for 24 h. Relative pRRM2/RRM2 ratios between groups were also calculated and graphed. b RRM2 was phosphorylated at T33. pRRM2 and RRM2 levels were measured by immunoblotting with anti-Myc antibodies following electrophoresis in Phos-tag™-containing gels of HepG2 cells ectopically expressing RRM2 WT , RRM2 T33A or RRM2 T33E before and after treatment with erastin (10 μM) for 24 h. c RRM2 and GSS were measured by immunoblotting in RRM2 −/− HepG2 and SMMC-7721 cells ectopically expressing RRM2 WT , RRM2 T33A or RRM2 T33E before and after treatment with erastin (10 μM) for 24 h. d RRM2 and GSS were degraded by proteasomes. RRM2 and GSS were measured by immunoblotting in HepG2 cells with the indicated treatments. Erastin and MG132 were treated at concentrations of 10 μM and 8 μM, respectively, for 24 h. e Colocalization of GSS (upper) or RRM2 (lower) with PSMB5 in HepG2 cells cultured in the presence or absence of erastin (10 μM, 24 h). Scale bar, 20 μm. f Association of RRM2, GSS and PSMB5 in proteasomes isolated from HepG2 cells cultured in the presence or absence of erastin (10 μM, 24 h) in the presence of MG132 (8 μM, 24 h). Samples from affinity or control beads were analyzed in parallel. g Erastin (10 μM, 24 h) chase of GSS and RRM2 in RRM2 −/− HepG2 and SMMC-7721 cells reconstituted with RRM2 WT , RRM2 T33A or RRM2 T33E . The levels of GSS were also normalized to those of GAPDH, and the normalized level of GSS in the 0 h group was arbitrarily set to 100%. The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. Data from a were analyzed using a one-way ANOVA test. Data from e were analyzed using Student’s t test

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Phospho-proteomics, Western Blot, Electrophoresis, Cell Culture, Expressing, Isolation, Control

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Dephosphorylation of RRM2 stimulates RRM2 binding with GSS to promote their corecruitment to the proteasome and subsequent activation of ferroptosis. a , b Reciprocal IP experiments of RRM2 and GSS in RRM2 −/− HepG2 cells reconstituted with RRM2 WT , RRM2 T33A or RRM2 T33E . The amount of proteins in the immunoprecipitates was normalized to that in whole-cell lysates (Input), and was graphed in the lower panel. c , d Reciprocal IP experiments for RRM2 and GSS in HepG2 cells with or without NU6102 (20 μM, 24 h) and SB203580 (10 μM, 24 h) treatment. The amount of protein in the immunoprecipitates was normalized to that in whole-cell lysates (Input), and was graphed in the lower panel. e Proximal protein ligation between endogenous GSS and the indicated exogenous RRM2-Myc, as measured by PLA in HepG2 cells expressing RRM2 WT , RRM2 T33A or RRM2 T33E . Scale bar, 20 μm. The PLA signals were also calculated and graphed, and the data from the “Empty” group were arbitrarily set to 1. f RRM2 WT , RRM2 T33A or RRM2 T33E was expressed in reconstituted RRM2 −/− HepG2 cells. Immunoprecipitations were acquired with anti-PSMB5 antibodies and further analyzed by immunoblotting using anti-RRM2 and anti-GSS antibodies. GSS and RRM2 enrichment in the immunoprecipitates was calculated as the normalization to the levels in whole-cell lysates (input). g – i GSH ( g ), cell death ( h ) and 4-HNE ( i ) were measured in HepG2 and SMMC-7721 cells with or without RRM2 knockdown before they were further treated with Fer-1 (1 μM, 24 h), ZVAD-FMK (20 μM, 24 h), Nec-1 (20 μM, 24 h), or ectopically expressed GSS, RRM2 T33A or RRM2 WT in the presence or absence of NU6102 (20 μM, 24 h). The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. The data from a – d and f – i were analyzed using one-way ANOVA

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: De-Phosphorylation Assay, Binding Assay, Activation Assay, Ligation, Expressing, Western Blot, Knockdown

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Relationship among serum RRM2, serum AFP and the parameters of liver function in liver cancer patients. The relationships between serum RRM2 levels and serum AFP ( a ), CEA ( b ), ALT( c ), AST ( d ), ALP ( e ), γ-GT ( f ), ALB ( g ), and total bilirubin ( h ) in liver cancer patients are shown. Data from 185 liver cancer patients (from three biological replicates) were used to analyze the relationship using Spearman's rank correlation coefficient

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques:

Journal: Cancer Cell International

Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer

doi: 10.1186/s12935-020-01689-8

Figure Lengend Snippet: Diagnostic value of serum RRM2 in predicting liver cancer. a ROC curves for serum RRM2, AFP, and the combination of serum RRM2 and AFP for the discriminating patients with liver cancer from healthy individuals. The AUC value represents the combined effects of the sensitivity and specificity of single or combined biomarkers in the diagnosis of patients with liver cancer. All the data were obtained from three biological replicates. b Serum RRM2 is positively associated with tumor stage in liver cancer patients. The first quartile of serum RRM2 levels in liver cancer patients was no more than 300 pg/ml, the second quartile was from 300 to 1200 pg/ml, and the bottom quartile was more than 1200 pg/ml. Liver cancer patients were divided into three groups according to these quartiles. All the data were from three biological replicates. The associations between tumor stage and serum RRM2 in liver cancer patients were analyzed using the χ 2 test. c Correlation between intracellular RRM2 and RRM2 in culture medium from liver cancer cell lines as analyzed by Spearman rank-correlation analysis. d RRM2 expression across multiple cancer types from the UALCAN database. TPM, transcriptions per million. e The model of the study. Under homeostasis, RRM2 is phosphorylated at the T33 site (can be dephosphorylated by NU6102) to sustain GSS and GSH levels and suppress potential ferroptosis. In the ferroptotic state, RRM2 is dephosphorylated and has increased affinity GSS, leading to the subsequent proteasomal degradation of both proteins. With such an effect, GSH eventually declines to facilitate ferroptosis. The data from a-c are shown from three biological replicates. Analysis of the receiver operator characteristics (ROC) and calculation of the area under the curve (AUC) was performed to find the diagnostic values of RRM2, AFP and the combination of RRM2 and AFP for the prediction of liver cancer. **P < 0.01 indicates statistical significance. Data from b were analyzed using the χ 2 test. Data from c were analyzed by Spearman rank-correlation analysis. Data in d were analyzed using Student’s t test

Article Snippet: RRM2 overexpression and RRM2 sh1 knockdown plasmids were obtained from Origene (Beijing, China).

Techniques: Diagnostic Assay, Biomarker Discovery, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Gene Expression, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot

Journal: Molecular Cell

Article Title: Ribonucleotide Reductase Requires Subunit Switching in Hypoxia to Maintain DNA Replication

doi: 10.1016/j.molcel.2017.03.005

Figure Lengend Snippet:

Article Snippet: Mouse monoclonal anti-RRM2 Clone 1E1 , Bio-Rad , Cat# MCA3434Z.

Techniques: Transduction, Recombinant, Protease Inhibitor, SYBR Green Assay, Mutagenesis, Purification, Gel Extraction, Imaging, Sequencing, Negative Control, Real-time Polymerase Chain Reaction, Software, Expressing

Journal: Acta Neuropathologica

Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS

doi: 10.1007/s00401-022-02471-y

Figure Lengend Snippet: HNRNPK dysfunction induces RRM2 deficiency and nuclear translocation. a , b Volcano plots showing differentially expressed genes in 30 hpf C9 repeat RNA (91S + GFP) zebrafish embryos compared to GFP control embryos ( a ) and 91S + HNRNPK- compared to 91S + GFP-injected embryos ( b ). Significant ( P < 0.0001) up- or down-regulated genes with a logFC > 1 or < − 1 and a logFC > 0.5 or < − 0.5 are indicated in red and blue respectively. Turquoise dots represent all non-significant differentially expressed genes. RRM2 transcripts are downregulated in C9 repeat RNA zebrafish embryos ( a ) and are upregulated upon overexpression of HNRNPK ( b ). c Bar graph showing the relative RRM2 fold change ( N = 2 biological replicates). d , e Effect of RRM2 mRNA injection (0.314 µM) on the 91S repeat RNA-induced axonopathy on axonal length ( d ) and abnormal branching ( e ) ( N = 4 experiments). Data represent mean ± SEM. Statistical significance was evaluated with one-way ANOVA and Tukey’s multiple comparison test;**** P < 0.0001. P values are indicated for comparison of abnormal branching. f Western blot detecting RRM2 protein levels in post-mortem motor cortex of non-neurodegenerative controls and C9 ALS/FTD . Total protein was used to normalize data. g Relative quantification of RRM2 protein levels in 5 non-neurodegenerative controls and 7 C9 patients. Data represent mean ± SEM. Statistical significance was evaluated with unpaired t test; ** P < 0.01. ( h , i ) Immunohistochemical detection of RRM2 in motor cortex of a representative non-neurodegenerative control ( h ) and a C9orf72 ALS ( i ) case. Arrowheads indicate nuclei of neuronal cells stained negative ( h ) or positive ( i ) for RRM2. Scale bar = 50 µm. j , k Percentage of cells containing nuclei that stain positive ( j ) and negative ( k ) for RRM2 in motor cortex of 5 non-neurodegenerative controls and 5 C9 patients. Data represent mean ± SEM. Statistical significance was evaluated with unpaired t test; ** P < 0.01

Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and RRM2 (RC228362, Origene) plasmid constructs were digested with Age I. HNRNPK deletion constructs were synthesized by Genscript (Piscataway, USA) in a pUC57 vector and subcloned in a pCMV6-Entry vector (PS100001, Origene).

Techniques: Translocation Assay, Control, Injection, Over Expression, Comparison, Western Blot, Quantitative Proteomics, Immunohistochemical staining, Staining

Journal: Acta Neuropathologica

Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS

doi: 10.1007/s00401-022-02471-y

Figure Lengend Snippet: HNRNPK and RRM2 are implicated in the DNA damage response in C9 RNA toxicity. a Western blot detecting HNRNPK and RRM2 levels. The upper panel shows the confirmation of reduced HNRNPK protein levels in HeLa cells transfected with HNRNPK siRNA and treated with DMSO or 10 µM CPT. In the middle panel, RRM2 protein levels in untransfected, control siRNA (siCtrl)- and HNRNPK siRNA (siHNRNPK)-transfected cells are presented. Total protein staining was used as loading control (lower panel). b , c Quantification of HNRNPK ( b ) and RRM2 ( c ) protein levels in untransfected CPT-treated cells, or in cells transfected with siCtrl or siHNRNPK ( N = 4–5 experiments). d – g Quantification of HNRNPK ( d, f ) and RRM2 levels ( e , g ) in siCtrl- ( d , e ) or siHNRNPK-transfected cells ( f , g ) treated with DMSO or CPT ( N = 5 experiments). h Western blot detecting reduced RRM2 levels in siHNRNPK-transfected cells compared to cells transfected with siCtrl and collected 4 h post-treatment (upper panel). No difference is observed between DMSO- and CPT-treated cells. Total protein staining was used as loading control (lower panel). i Quantification of RRM2 protein levels ( N = 6 experiments). j , k Immunostaining of RRM2 in siCtrl- ( j ) and siHNRNPK-transfected cells ( k ). l Quantification of nuclear and cytoplasmic RRM2 protein levels measured as mean fluorescence intensity ratio ( N = 3 experiments, 2 technical replicates). Each data point represents the average N/C ratio per replicate. In total, 10 images were analyzed per experiment and per condition. Scale bar = 50 µm. m , n Immunostaining of γH2AX foci in siCtrl- ( m ) and siHNRNPK-transfected ( n ) HeLa cells. Scale bar = 50 µm. o Quantification of the average number of γH2AX foci per cell ( N = 3 experiments). p – s Immunostaining of γH2AX foci in GFP ( p ), 91S + GFP ( q ), 91S + HNRNPK ( r ) and 91S + RRM2 ( s ) RNA-injected 30 hpf zebrafish embryos. Dotted lines indicate the borders of the spinal cord. Scale bar = 50 µm. t Quantification of the fold change of γH2AX positive nuclei in the spinal cord of zebrafish embryos ( N = 3 experiments). b – g , i , l , o , t Data represent mean ± SEM. Statistical significance was evaluated with one-way ANOVA and Tukey’s multiple comparison test ( b , c , t ), unpaired t test ( d – g , l ) or Kruskal–Wallis test and Dunn’s multiple comparison test ( i , o ); * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001

Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and RRM2 (RC228362, Origene) plasmid constructs were digested with Age I. HNRNPK deletion constructs were synthesized by Genscript (Piscataway, USA) in a pUC57 vector and subcloned in a pCMV6-Entry vector (PS100001, Origene).

Techniques: Western Blot, Transfection, Control, Staining, Immunostaining, Fluorescence, Injection, Comparison

Journal: Acta Neuropathologica

Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS

doi: 10.1007/s00401-022-02471-y

Figure Lengend Snippet: Schematic model linking mechanistic insights of HNRNPK and RRM2 in C9orf72 ALS. In the left panel, event of naturally occurring DNA damage (1) in a healthy neuron with consequential RRM2 activation and nuclear translocation (2). HNRNPK is a transcriptional regulator of RRM2 (3), essential for DNA repair in the DNA damage response (4). In the right panel, a neuron affected in C9 ALS/FTD is characterized by DPRs and RNA foci, consisting of C9orf72 repeat RNA and sequestered RNA-binding proteins, including HNRNPK (1a). Next to sequestration, HNRNPK is mislocalized to the cytoplasm (1b), resulting in a loss-of-function of HNRNPK, and directly or indirectly increasing DNA damage, which activates RRM2 (3). Loss-of-function achieves transcriptional dysregulation of downstream effectors of HNRNPK, including RRM2 (4). Activated, though depleted RRM2 results in a disrupted DNA damage response, impeding DNA repair (5). Scheme created with BioRender.com

Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and RRM2 (RC228362, Origene) plasmid constructs were digested with Age I. HNRNPK deletion constructs were synthesized by Genscript (Piscataway, USA) in a pUC57 vector and subcloned in a pCMV6-Entry vector (PS100001, Origene).

Techniques: Activation Assay, Translocation Assay, RNA Binding Assay

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) dNTP production in small interfering RNA (siRNA)-transfected cells. dNTP was detected at both 48 hours and 72 hours post-transfection of siRNAs in C4-2 cells. siNS, nonspecific siRNA. (B) siRRM2-induced DNA damage. DNA damage marker activation was monitored in LNCaP and C4-2 cells using Muse multi-color DNA damage kit. (C) Activation of H2A.X was confirmed by immunoblotting. (D) and (E) Analysis of cell proliferation (D) and cell cycle (E) in transfected cells. (F) Apoptosis detected by Annexin V assays and immunoblots. (G) dNTP production in empty vector (EV)/RRM2-overexpressing PC-3 cells (PC3-EV; PC3-RRM2). (H) Cell proliferation in stable cells. (I) soft agar assays of stable PC-3 cells. The colony numbers were normalized to those in the control cells. (J) Wound healing assays after the scratch done for 24 hours. (K) Invasion assays after cells were plated for 48 hours. (L) and (M) EMT marker expression detected by qPCR (L) and immunoblots (M) in both EV- and RRM2-expressing PC-3 cells. (N) Invasion assays after multiple siRNAs were transfected in PC3-RRM2 cells. Figure 1 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001 vs control groups treated with empty vector (EV) or with nonspecific (siNS) siRNA.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Small Interfering RNA, Transfection, Marker, Activation Assay, Western Blot, Plasmid Preparation, Control, Expressing

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A)-(C) The correlation of gene alteration with the fraction of genome altered (FGA) and Gleason grades in TCGA cohort was visualized in (A). The statistical quantitation was shown in (B) and (C). (D) The correlation of RRM2 level with Gleason grade in tumor and matched normal tissues in the PHS/HPFS cohorts. (E) and (F) The correlation of RRM2 expression with tumor progression in Taylor and Grasso cohorts. RRM2 levels were analyzed in prostate gland (PG), primary (Pri), and metastasis (Met) tissue samples. (G) The association of RRM2 expression and the disease-free survival in the TCGA, Taylor, and Glinsky cohorts. (H) The correlation of RRM2 with the risk of lethal prostate cancer over long-term follow-up, independent from clinical characteristics and Gleason grade, in the combined HPFS and PHS prostate cancer cohorts. The odd ratios for lethal disease were adjusted for Gleason score. ****, p<0.0001 vs comparator groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Quantitation Assay, Expressing

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) Gene set enrichment analysis (GSEA) of transcriptomic changes. The histograms showed the distribution of select top GSEA molecular signatures: MYC targets (MYC_up_V1_up gene set); E2F targets (hallmark_E2F_targets gene set), cell cycle (Module_54 gene set), p53 pathway (hallmark_p53_pathway), and apoptosis (hallmark apoptosis). Up-gene (up-regulated genes); Down-gene (down-regulated genes). (B) Multiple targets of pathways were validated by quantitative reverse transcription PCR (qRT-PCR). (C) siRRM2-regulated gene profiling and the correlation of these genes with disease-free survival (DFS) in Taylor cohort. (D) Significant enrichment in EMT and Angiogenesis gene sets in RRM2-overexpressing PC-3 cells. (E) RRM2-regulated 126-gene profiling and correlation with the clinical outcome in clinical cohorts. 126 genes were revealed by overlapping 1230 up-regulated genes in PC3-RRM2 cells with 627 common genes positively correlated with RRM2 overexpression in three prostate cancer cohorts (TCGA, Kumar, and SU2C/PCF). The correlation of these genes with disease-free survival was analyzed in the Taylor cohort.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Reverse Transcription, Quantitative RT-PCR, Over Expression

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) dNTP production in COH29-treated C4-2 cells. Two doses of COH29 were used in C4-2 cells, and dNTP production was detected after 24 hours of treatment. (B) and (C) Activation of DNA damage markers. (D) Cell proliferation assay. (E) Cell cycle analysis after 48 hours of COH29 treatment. (F) COH29-induced apoptosis. (G) The global mRNA changes induced by COH29 in C4-2 cells, after 48 hours of treatment. (H) GSEA analysis of mRNA profiling in 20 μM of COH29-treated cells. The histograms showed the distribution of select top GSEA molecular signatures. Up-gene (COH29-induced up-regulated genes); Down-gene (COH29-induced down-regulated genes). NES, normalized enrichment score; FDR, false discovery rate. (I) and (J) Identification of targeted genes by inhibition of RRM2. Genes affected by inhibition of RRM2 in cells were overlapped with genes correlated with RRM2 overexpression in Taylor cohort to reveal 33 down-regulated genes and 12 up-regulated genes (I). These gene panels were validated in three additional prostate cancer cohorts (J). The Figure 4 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Activation Assay, Proliferation Assay, Cell Cycle Assay, Inhibition, Over Expression, Control

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A)-(B) Phospho-kinase array analysis after 24-hour COH29 treatment in C4-2 cells. The whole-cell lysates were collected for human phospho-kinase array analysis. Each membrane contains kinase-specific antibodies (number indicated). Relative phosphorylation of spots was quantified by Image J software and the value of vehicle (0 μM) was set up as “1” (B). (C) Validation of phospho-kinase array by immunoblots. For siRNA-treated groups, cell lysates were collected after transfection for 48 hours. The representative blots for each condition are shown and the values represent the mean ± S.E. of two independent experiments. (D) Druggable RRM2 signatures. Top three drugs from ToppGene analysis and COH29 are shown (left panel). Numbers of genes down-regulated by docetaxel (in PC-3 cells) and docetaxel + ADT (in patients) are shown (right panel). (E)-(F) Antitumor effects of COH29 in vivo. Tumor volumes and weights were measured following oral administration of COH29 (200 mg/kg) in established C4-2 xenograft tumors (n=6 per group). Values are means ± S.E. ***P<0.001 versus vehicle mice. (G)-(H) Regulation of key genes by COH29 in vivo. Multiple genes regulated by COH29 were assessed in xenograft tumors by immunohistochemistry staining (G) or immunoblotting (H).

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: Membrane, Phospho-proteomics, Software, Biomarker Discovery, Western Blot, Transfection, In Vivo, Immunohistochemistry, Staining

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: A novel mechanism driving poor-prognosis prostate cancer: overexpression of the DNA repair gene, ribonucleotide reductase small subunit M2 (RRM2)

doi: 10.1158/1078-0432.CCR-18-4046

Figure Lengend Snippet: (A) H3K27Ac ChIP-Seq in tissues. The binding signal on RRM2 enhancer (1Mb region) was quantified. (B) The strategy to identify RRM2-targeting transcription factors (TFs). Human TFs were selected in the genes positively correlated with RRM2 expression in prostate cancer cohorts. Yellow/orange/pink bars indicate that TFs appear in four/three/two cohorts. (C) The correlation of FOXM1 and RRM2 in PHS/HPFS cohorts. (D) FOXM1 binding on RRM2 promoter in cancer cells. The overview of multiple ChIP-Seq datasets were extracted from Cistrome Data browser. P1-P3 primers were designed for FOXM1 ChIP-PCR. (E) FOXM1 or H3K4me3-ChIP-PCR on RRM2 promoter. (F) RRM2 promoter activity regulated by FOXM1. The reporters without (R2-0K) or with (R2-3K) 3kb RRM2 promoter sequence were transfected in siRNA-treated 22Rv1 cells. (G) and (H) Inhibition of RRM2 expression by siFOXM1 in 22Rv1 and C4-2 cells. (I) Inhibition of FOXM1 targets by FDI-6 (20 μM) in 22Rv1 cells. The Figure 6 values represent the mean ± S.E. of three independent experiments. *, p<0.05; **, p<0.01; ***, p<0.001 vs control groups.

Article Snippet: For luciferase reporter assays, siRNAs were transfected in cells for 24 hours and 500 ng of RRM2 promoter reporters (GeneCopoeia) containing 0kb or 3kb promoter sequence of human RRM2 were cotransfected with Lipofectamine 2000 (Invitrogen).

Techniques: ChIP-sequencing, Binding Assay, Expressing, Activity Assay, Sequencing, Transfection, Inhibition, Control

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. The expression of RRM2 was detected via western blotting in synovial specimens from patients with RA and normal controls. The relative expression of RRM2 was shown in histogram. **p<0.01, compared to normal controls. B. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. The relative expression of RRM2 was shown in histogram. **p<0.01, compared with untreated group. ##p<0.01, compared with untreated group. C. MH7A cells were treated with RRM2 shRNA lentivirus and lentiviral controls for 24 h. The relative expression of RRM2 was determined via western blotting and shown in histogram. **p<0.01, compared with control lentivirus group. D. MTT assay. MH7A cells were infected with RRM2 shRNA lentivirus and lentiviral controls for 24, 48, and 72 h, and cell viability was determined via MTT assay. **p<0.01. E. Clone formation assay. MH7A cells were infected with RRM2 shRNA and control shRNA lentivirus and cultured for 2 weeks. Colony formation assay was performed as described in Materials and Methods. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. F. Migration and invasion assays. MH7A cells were infected with RRM2 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α. The migratory and invasive abilities were detected using transwell Boyden chamber coated without or with a Matrigel basement membrane matrix after 48 h. Original magnification ×100.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Expressing, Western Blot, shRNA, MTT Assay, Infection, Tube Formation Assay, Cell Culture, Colony Assay, Migration, Membrane

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: IGF2BP3-RRM2 association.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques:

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. IGF2BP3 RIP assay. IGF2BP3 immunoprecipitation was performed and detected by Western blotting in TNF-α or IL-1β-treated MH7A cells. GAPDH and IgG was used as the negative control. B. RIP-qPCR assay demonstrated the enrichment of RRM2 mRNA in in anti-IGF2BP3 precipitates of TNF-α or IL-1β-treated MH7A cells(**p<0.01). C. MeRIP-qPCR assay. The m6A enrichment of RRM2 mRNA was shown by using anti-IgG and anti-m6A antibodies in TNF-α or IL-1β-treated MH7A cells after knocking down IGF2BP3. **P < 0.01.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Immunoprecipitation, Western Blot, Negative Control

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. MH7A cells were treated with TNF-α (10 ng/mL) and IL-1β (10 mg/L) for 24 h, and the expression of RRM2 was determined via western blotting. B. The relative expression of IGF2BP3, RRM2, MMP-9 and MMP-1 was shown in histogram. **p<0.01, compared with control group. C. MH7A cells were infected with IGF2BP3 shRNA and control shRNA lentiviruses and treated with 10 ng/mL of TNF-α for 24 h. The expression of IGF2BP3, RRM2, MMP-9, and MMP-1 was detected via western blotting. D. The relative expression of IGF2BP3, RRM2, MMP-9 and MMP-1 was shown in histogram. **p<0.01, compared with control shRNA group.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Expressing, Western Blot, Infection, shRNA

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. MTT assay. MH7A cells were infected with IGF2BP3 shRNA lentivirus and control shRNA lentivirus was treated with TNF-α (10 ng/mL) for 24, 48, and 72 h. The cell viability was determined using MTT assay. **p<0.01, compared with control shRNA group. B. Clone formation assay. MH7A cells were infected with IGF2BP3 shRNA and control shRNA lentivirus and cultured for 2 weeks. The colony number was shown in histogram. **p<0.01, compared with control shRNA group. C. Migration and invasion assays. The effects of IGF2BP3 knockdown on invasion and migration were detected using transwell Boyden chamber coated with or without a Matrigel basement membrane matrix after 48 h. Original magnification ×100. D. MTT assay. MH7A cells were treated with IGF2BP3 shRNA lentivirus and overexpressed control lentivirus, control shRNA lentivirus and overexpressed RRM2 lentivirus, IGF2BP3 shRNA lentivirus and overexpressed control lentivirus, and IGF2BP3 shRNA lentivirus and overexpressed RRM2 lentivirus for 24, 48, and 72 h. Cell viability was determined using MTT assay. **p<0.01, compared with control group.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: MTT Assay, Infection, shRNA, Tube Formation Assay, Cell Culture, Migration, Membrane

Journal: PLOS ONE

Article Title: IGF2BP3 regulates the expression of RRM2 and promotes the progression of rheumatoid arthritis via RRM2/Akt/MMP-9 pathway

doi: 10.1371/journal.pone.0303593

Figure Lengend Snippet: A. MH7A cells were infected with RRM2 shRNA or control shRNA lentiviruses for 48 h. The expression of RRM2, phosphorylated Akt, total Akt, and MMP-9 was detected via western blotting. The relative expression of RRM2, p-Akt, Akt and MMP-9 was shown in histogram. **p<0.01, compared with control shRNA group. B. The MH7A cells infected with RRM2 shRNA or control shRNA lentiviruses were treated with Akt inhibitor for 24 h. The expression of pAkt-S473, total Akt, and MMP-9 was detected via western blotting. The relative expression of RRM2, p-Akt, Akt, MMP-1 and MMP-9 was shown in histogram. **p<0.01, ##p<0.01, compared with control group.

Article Snippet: RRM2 Lentiviral copy DNA Open Reading Frame Clone, Human, C-GFPSpark® tag (Cat: HG18284-ACGLN) and pLV-C-GFPSpark lentivirus control plasmid (Cat: LVCV-35) were purchased from SinoBiological corporation (Beijing, China).

Techniques: Infection, shRNA, Expressing, Western Blot